This is a demonstration environment. It may contain non-accurate test data and should not be used for real-world applications. Data will be deleted regularly.
Display Name: Pakistan/LOC_000YGQ6.1/2023-09-25
M. Umair, S. A. Haider, Z. Jamal, M. Ammar, R. Hakim, Q. Ali & M. Salman

Sample details

Collection date
2023-09-25
Collection date (lower bound)
2023-09-25
Collection date (upper bound)
2023-09-25
Earliest release date
2023-12-26
Collection country
Pakistan
Isolate name
CCHF/NIHPAK-11/2023

Data use terms

Data use terms
OPEN
Data use terms URL

Authors

Author affiliations
National Institute of Health, Department of Virology

INSDC

NCBI release date
2023-12-26
INSDC accession L
INSDC accession M
INSDC accession S

Host

Host taxon id
Host name scientific
Homo sapiens

Alignment and QC metrics L

Length L
12159
Total SNPs L
1643
Total inserted nucs L
51
Total deleted nucs L
0
Total ambiguous nucs L
0
Total unknown nucs L
1
Total frame shifts L
0
Completeness L
99.99%

Alignment and QC metrics M

Length M
5345
Total SNPs M
1026
Total inserted nucs M
1
Total deleted nucs M
1
Total ambiguous nucs M
0
Total unknown nucs M
44
Total frame shifts M
0
Completeness M
98.79%

Alignment and QC metrics S

Length S
1651
Total SNPs S
232
Total inserted nucs S
1
Total deleted nucs S
0
Total ambiguous nucs S
0
Total unknown nucs S
0
Total frame shifts S
0
Completeness S
98.68%

Submission details

Submission ID
OR964931.1.L/OR964942.1.M/OR964920.1.S
Date submitted
2025-10-22 14:40:13 UTC
Date released
2025-10-22 14:46:33 UTC

Lineage

Segment S Lineage
IV.1

Files

Nucleotide mutations

Mutations called relative to the NC_005301.3, NC_005300.2 & NC_005302.1 references

Substitutions

L

  • L:T10C
  • L:G23T
  • L:A35G
  • L:G43T
  • L:C48T
  • L:T49C
  • L:C63G
  • L:C64T
  • L:T65C
  • L:T66C
  • L:T68C
  • L:G69A
  • L:G71C
  • L:G88A
  • L:G93A
  • L:A109G
  • L:C117A
  • L:A124G
  • M

  • M:G50T
  • M:A51G
  • M:G56A
  • M:A57C
  • M:A70G
  • M:T71A
  • M:T72C
  • M:G76T
  • M:A80G
  • M:T83C
  • M:C85T
  • M:T86C
  • M:A90G
  • M:T91C
  • M:C92T
  • M:A93G
  • M:T98C
  • M:T100C
  • S

  • S:A50G
  • S:G54A
  • S:G76A
  • S:T79C
  • S:A85G
  • S:T88C
  • S:G91A
  • S:T106C
  • S:A109G
  • S:A118G
  • S:A121G
  • S:C142A
  • S:T144A
  • S:C145T
  • S:A148G
  • S:C166T
  • S:G169A
  • S:G171A
  • Deletions
    M:5257
    Insertions
    ins_L:58:T, ins_L:11915:AA, ins_L:12054:TAAAATTTT, ins_L:12083:ACTATTC, ins_L:12108:TTTGTTATTTCTGGGGTGTGGGGGGAACGATT, ins_M:5170:G, ins_S:1574:T

    Amino acid mutations

    Mutations called relative to the NC_005301.3, NC_005300.2 & NC_005302.1 references

    Substitutions

    GPC

  • GPC:M1V
  • GPC:I3T
  • GPC:S4L
  • GPC:M6V
  • GPC:I9V
  • GPC:L10F
  • GPC:C15W
  • GPC:G16S
  • GPC:L17P
  • GPC:E19G
  • GPC:S23L
  • GPC:H24S
  • GPC:R28Q
  • GPC:H29Y
  • GPC:K31S
  • GPC:D33S
  • GPC:T34I
  • GPC:M35T
  • NP

  • NP:F30Y
  • NP:S39N
  • NP:V83A
  • NP:S109N
  • NP:D116E
  • NP:T124S
  • NP:G125N
  • NP:D199E
  • NP:V205I
  • NP:I246V
  • NP:S301G
  • NP:A307V
  • NP:E322D
  • NP:Q405L
  • NP:V436I
  • NP:A450S
  • RdRp

  • RdRp:S6N
  • RdRp:A14D
  • RdRp:S19T
  • RdRp:Y60N
  • RdRp:R63H
  • RdRp:S67V
  • RdRp:R80K
  • RdRp:V82I
  • RdRp:I114V
  • RdRp:T163A
  • RdRp:A168T
  • RdRp:M172V
  • RdRp:R174K
  • RdRp:E203D
  • RdRp:S205P
  • RdRp:N206Y
  • RdRp:V214I
  • RdRp:I223V
  • Deletions
    None
    Insertions
    None

    Report an issue with this sequence or metadata

    Create GitHub issue