This is a demonstration environment. It may contain non-accurate test data and should not be used for real-world applications. Data will be deleted regularly.
Display Name: Pakistan/LOC_000YGLE.1/2023-08-30
M. Umair, S. A. Haider, Z. Jamal, M. Ammar, R. Hakim, Q. Ali & M. Salman

Sample details

Collection date
2023-08-30
Collection date (lower bound)
2023-08-30
Collection date (upper bound)
2023-08-30
Earliest release date
2023-12-26
Collection country
Pakistan
Isolate name
CCHF/NIHPAK-21/2023

Data use terms

Data use terms
OPEN
Data use terms URL

Authors

Author affiliations
National Institute of Health, Department of Virology

INSDC

NCBI release date
2023-12-26
INSDC accession L
INSDC accession M
INSDC accession S

Host

Host taxon id
Host name scientific
Homo sapiens

Alignment and QC metrics L

Length L
12146
Total SNPs L
1220
Total inserted nucs L
49
Total deleted nucs L
1
Total ambiguous nucs L
0
Total unknown nucs L
814
Total frame shifts L
0
Completeness L
93.19%

Alignment and QC metrics S

Length S
1648
Total SNPs S
169
Total inserted nucs S
1
Total deleted nucs S
0
Total ambiguous nucs S
0
Total unknown nucs S
96
Total frame shifts S
0
Completeness S
92.76%

Alignment and QC metrics M

Length M
5364
Total SNPs M
584
Total inserted nucs M
13
Total deleted nucs M
0
Total ambiguous nucs M
0
Total unknown nucs M
158
Total frame shifts M
1
Frame shifts M
GPC:420-1685(nt:1349-5147)
Completeness M
96.78%

Submission details

Submission ID
OR964927.1.L/OR964938.1.M/OR964916.1.S
Date submitted
2025-10-22 14:40:13 UTC
Date released
2025-10-22 14:46:33 UTC

Lineage

Segment S Lineage
IV.1

Files

Nucleotide mutations

Mutations called relative to the NC_005301.3, NC_005300.2 & NC_005302.1 references

Substitutions

L

  • L:G23T
  • L:A35G
  • L:C63G
  • L:C64T
  • L:T65C
  • L:T66C
  • L:G69A
  • L:G71T
  • L:G88A
  • L:G93A
  • L:A109G
  • L:A124G
  • L:T131A
  • L:T139C
  • L:T154C
  • L:T160C
  • L:C208T
  • L:T250C
  • M

  • M:C82T
  • M:C85T
  • M:T86C
  • M:A107G
  • M:A117G
  • M:C119T
  • M:C120T
  • M:T122C
  • M:C126T
  • M:A128G
  • M:T137C
  • M:G143A
  • M:A146G
  • M:G147A
  • M:A169G
  • M:A170G
  • M:G175A
  • M:A185T
  • S

  • S:A50G
  • S:G54A
  • S:G67A
  • S:T79C
  • S:G99A
  • S:A109G
  • S:A118G
  • S:C166T
  • S:G169A
  • S:T172C
  • S:C178A
  • S:T182C
  • S:G190A
  • S:T199C
  • S:C208T
  • S:C217T
  • S:G229A
  • S:C235T
  • Deletions
    L:12034
    Insertions
    ins_L:58:T, ins_L:11925:GT, ins_L:12055:ACAATTTC, ins_L:12083:ACTATTC, ins_L:12108:TTTATTATTTCTGGGGTGTGGGGGGAACGAT, ins_M:1348:A, ins_M:5219:C, ins_M:5366:TAAATCTTGAC, ins_S:1577:A

    Amino acid mutations

    Mutations called relative to the NC_005301.3, NC_005300.2 & NC_005302.1 references

    Substitutions

    GPC

  • GPC:I9V
  • GPC:L10F
  • GPC:E26G
  • GPC:K31N
  • GPC:D33H
  • GPC:T34V
  • GPC:G39D
  • GPC:N41S
  • GPC:P42Q
  • GPC:S44P
  • GPC:S53P
  • GPC:I54V
  • GPC:L56P
  • GPC:P80S
  • GPC:G85K
  • GPC:S86G
  • GPC:P88S
  • GPC:S90P
  • NP

  • NP:R15K
  • NP:V83A
  • NP:D116E
  • NP:T124S
  • NP:G125N
  • NP:H195R
  • NP:I246V
  • NP:S301G
  • NP:A307V
  • NP:Q405L
  • NP:V436I
  • RdRp

  • RdRp:S6N
  • RdRp:S19T
  • RdRp:Y60N
  • RdRp:R63H
  • RdRp:S67V
  • RdRp:R80K
  • RdRp:V82I
  • RdRp:I114V
  • RdRp:T163A
  • RdRp:A168T
  • RdRp:M172V
  • RdRp:S205P
  • RdRp:N206Y
  • RdRp:K275R
  • RdRp:I279V
  • RdRp:I505T
  • RdRp:A508V
  • RdRp:G762E
  • Deletions
    None
    Insertions
    None

    Report an issue with this sequence or metadata

    Create GitHub issue