This is a demonstration environment. It may contain non-accurate test data and should not be used for real-world applications. Data will be deleted regularly.
Display Name: Tajikistan/LOC_000Q1BW.1/2019-08-16
J. D'Addiego, M. Mullojanova, T. Hikmatov, F. Tishkova & R. Hewson

Sample details

Collection date
2019-08-16
Collection date (lower bound)
2019-08-16
Collection date (upper bound)
2019-08-16
Earliest release date
2025-07-27
Collection country
Tajikistan
Isolate name
CCHFV_F.Kh.49

Data use terms

Data use terms
OPEN
Data use terms URL

Authors

Author affiliations
UK Health Security Agency, Research & Evaluation

INSDC

NCBI release date
2025-07-27
INSDC accession L
INSDC accession S

Host

Host taxon id
Host name scientific
Homo sapiens

Alignment and QC metrics L

Length L
12126
Total SNPs L
1622
Total inserted nucs L
44
Total deleted nucs L
3
Total ambiguous nucs L
26
Total unknown nucs L
0
Total frame shifts L
0
Completeness L
99.60%

Alignment and QC metrics S

Length S
1673
Total SNPs S
222
Total inserted nucs S
1
Total deleted nucs S
0
Total ambiguous nucs S
9
Total unknown nucs S
0
Total frame shifts S
0
Completeness S
99.46%

Submission details

Submission ID
PV953856.1.L/PV953855.1.S
Date submitted
2025-10-27 14:18:35 UTC
Date released
2025-10-27 14:25:03 UTC

Lineage

Segment S Lineage
IV.2

Files

Nucleotide mutations

Mutations called relative to the NC_005301.3, NC_005300.2 & NC_005302.1 references

Substitutions

L

  • L:A35G
  • L:G43C
  • L:C48T
  • L:C59T
  • L:C64T
  • L:T65G
  • L:G71T
  • L:A72T
  • L:C82T
  • L:C85T
  • L:G90A
  • L:G93A
  • L:A109G
  • L:G112A
  • L:T121C
  • L:G130T
  • L:T131A
  • L:C136T
  • S

  • S:C31T
  • S:T48C
  • S:G54A
  • S:A61G
  • S:C64T
  • S:G67A
  • S:T79C
  • S:G99A
  • S:A118G
  • S:C142T
  • S:T157C
  • S:C166T
  • S:C178A
  • S:T182C
  • S:G190A
  • S:G196A
  • S:C214T
  • S:C217T
  • Deletions
    L:11996, L:12086, L:12087
    Insertions
    ins_L:66:CC, ins_L:11927:GT, ins_L:12051:TAGTGCAATTCTTTCTAC, ins_L:12108:TTGATTATTTCTAGGGTGGGGG, ins_S:1579:A

    Amino acid mutations

    Mutations called relative to the NC_005301.3, NC_005300.2 & NC_005302.1 references

    Substitutions

    NP

  • NP:R15K
  • NP:D116E
  • NP:T124A
  • NP:N150H
  • NP:H195R
  • NP:D199E
  • NP:I246V
  • NP:R270K
  • NP:S275N
  • NP:S301G
  • NP:I395V
  • NP:V436I
  • RdRp

  • RdRp:R5K
  • RdRp:S6N
  • RdRp:S19T
  • RdRp:Y60N
  • RdRp:R63H
  • RdRp:S67V
  • RdRp:R80K
  • RdRp:V82I
  • RdRp:L90V
  • RdRp:I114V
  • RdRp:T163A
  • RdRp:T165M
  • RdRp:A168T
  • RdRp:M172V
  • RdRp:R174K
  • RdRp:A202V
  • RdRp:S205P
  • RdRp:N206Y
  • Deletions
    None
    Insertions
    None

    Report an issue with this sequence or metadata

    Create GitHub issue